Welcome to our FAQ page. Here you'll find answers to our most commonly asked questions about ClickSeq Technologies' products, services, and company. We've put together this resource to help you find the information you need quickly and easily. If you don't find what you're looking for, our team is always happy to help — feel free to reach out to us at info@clickseq.com
ClickSeq is a platform and method for making Next-Generation Sequencing libraries. It is called ‘ClickSeq’ as it replaces the ligations and fragmentation steps common to NGS library preps with ‘Click-Chemistry’.
Click-Chemistry is a broad term used to describe a group of organic chemical reactions that irreversibily link together two molecular entities and are generally characterized with properties such as speed of the reaction, specificity of the reaction, simple reaction conditions and a quantitative reaction that can reach completion in a short period of time. See https://en.wikipedia.org/wiki/Click_chemistry for more information.
ClickSeq employs a specific click-chemistry reaction called Copper-catalyzed azide-alkyne cycloaddition (CuAAC) to ‘click-ligate’ alkyne functionalized sequencing adaptors to azido-terminated cDNA molecular derived from an original biological specimen of interest. This replaces the enzymatic ligation reactions commonly used in most RNAseq/DNAseq approaches.
Poly(A)-ClickSeq is a specific variant of ClickSeq that used an Oligo-dT primer in the Reverse transcription step. cDNA fragments are thus focused to the 3’ ends of polyadenylated RNAs, such as metazoan mRNAs and viral genomic RNAs. As such, Poly(A)-ClickSeq provides a powerful platform for transcriptomics and differential gene expression analysis. Since only one NGS read is obtained per molecule of mRNA in a sample, the bioinformatics procedures are greatly simplied and the amount of sequence depth is greatly reduced (~10M reads required vs 100M per sample for a typical transcriptomics study). Additionally, Poly(A)-ClickSeq can be used to precisely map the junction of a poly(A)-tail within the 3’UTR of a mRNA. As such, it is an excellent tool for studying alternative polyadenylation and alternative 3’ exon usage.
Poly(A)-ClickSeq retains all the advantages of ClickSeq, such as the removal of fragmentation steps and a simplified workflow. In addition, Poly(A)-ClickSeq does not require any ribo-depletion or mRNA enrichment prior to the library prep, since the Oligo-dT primer automatically enriches for mRNAs and other species of interest. In some cases, Poly(A)-ClickSeq can even be performed directly on cells, without RNA extraction.
X-ClickSeq kits provide the same reagents as the ClickSeq kits, except that no primers are provided for the Reverse Transcription step. Rather, the user may use their own RT primer as per the requirements of their own assay. For example, a 9N random primer might be used instead of a 6N random primer; or a set of SARS-CoV-2 targeting tiled-primers might be used (see Jaworski et al. eLife, 2021). . All other aspects of the library prep are otherwise identical to ClickSeq. The data analysis pipeline will also be altered as per the assay design.
Jaworski et al, 2021, eLife
"Tiled-ClickSeq for targeted sequencing of complete coronavirus genomes with simultaneous capture of RNA recombination and minority variants"
In partnership with baseclick GmbH (baseclick.eu), we have developed and validated the following ClickSeq-based kits for NGS library preparation. Please visit https://www.baseclick.eu/product-category/assays/ngs/ for details.
ClickSeq: for random primed RNAseq or DNAseq (https://www.baseclick.eu/product/clickseq-library-prep-kit/)
Poly(A)-ClickSeq: for 3' end focused transcriptomics (https://www.baseclick.eu/product/polya-clickseq-library-prep-kit/)
X-ClickSeq: for use with user-provided primers in the Reverse Transcription step, allowing for customized, targeted and tiled assays (https://www.baseclick.eu/product/x-clickseq-library-prep-kit/)
ClickSeq follows the same principle of all NGS library preps that seek to generate short fragments of cDNAs that are flanked with the appropriate sequencing adaptor for the user’s choice of sequencing platform (e.g. Illumina).
The process works by supplementing the Reverse Transcription step of an NGS library prep with small amounts of terminating ‘azido-nucleotides’. These are stochastically incorporated into the cDNA during first stranded systhesis, yielding 3’azido-terminated cDNA molecules. The the azido group is then ‘Click-Ligated’ to an alkyne-functionalized sequencing adaptor using Click-Chemistry (Copper Catalysed Azide-Alkyne Cycloaddition, CuAAC). The resultant click-linked single-stranded cDNA is then PCR amplified to generate a final sequencing-ready NGS library.
The current kits contain a click-adaptor compatible only with single i7 indexing adaptors. Future versions will be compatible with dual-indexing. For more information or for custom adaptors, please reach out to us at info@clickseq.com
ClickSeq is compatible with paired or single-end sequencing. This is stipulated at the time of configuring the sequencing-platform’s flowcell.
In Poly(A)-ClickSeq, the R2 (second) read is contains nucleotides derived from the poly(A)-tail and oligo-dT primers. These homopolymeric tracts and subsequent lack of diversity in the flowcell’s clusters may reduce the base-calling quality in these regions, or some extreme cases result in the failure of the sequencing reaction. This can be addressed by mixing Poly(A)-ClickSeq libraries with other diverse libraries such as ‘normal’ ClickSeq or RNAseq libraries or spike-in control libraries such as PhiX.
Yes. The R1 read provides the FASTQ data in the same orientation as the original template/input. The R2 read is reverse-complemented relative to the original template and is derived from the priming-site of the RT reaction.
The current kits contain Illumina (TruSeq) i7 and i5 adaptors in the RT and Click-Ligation steps, respectively. As such, ClickSeq libraries synthesized using our kits can be clustered on Illumina platforms and Element Bioscience Aviti flowcells. Completed ClickSeq NGS libraries can also be sequenced on Oxford Nanopore Technologies’ flowcell after direction ligation of ONT adaptors to the ClickSeq libraries.
We’d be delighted to help support development of ClickSeq for your own specific protocols/applications. Please reach out to info@clickseq.com for further information.
Please reach out to info@clickseq.com for support and further questions.
No.
A valuable feature of ClickSeq™ is in the removal of any required fragmentation step. This simplifies work flow and removes the need for optimizing fragmentation procedures for a given RNAseq/DNAseq pipeline. The fragment lengths generated by ClickSeq are instead determined by the azido-nucleotide to deoxynucleotide ratio provided in the reverse transcription step. As such, the fragment length is independent of sequence composition or primer design and allows ClickSeq to be deployed even on unextracted biological samples and in situ.
The fragment length is determine by the ratio of AzNTPs to dNTPs in the reverse transcription reaction. We currently provide fixed ratios that we have optimized for random-primer ClickSeq or Poly(A)-ClickSeq. For custom or bespoke formulations, please reach out to info@clickseq.com
ClickSeq will sequence whatever nucleic acid is provided as input. If you have total cellular RNA, then much of this will comprise rRNA. rRNA can be depleted with most common ribodepletion strategies, including bead based depletion of the input RNA, or CRISPR-based depletion on the final NGS library. Published examples of this can be found here:
Click-chemistry itself is compatible with biological molecules/environments, and indeed Click-ligated nucleic acids have been made and used in a variety of in vitro and in vivo settings. All the click-ligation components are biocompatible.
The originally published protocol did not attempt to remove the copper-catalyst from the click-ligation reaction, but rather proceed directly to the PCR reaction. As a result, Cu ions would be present at the high-temp denaturation step of the PCR cycle, which has been suggested to result in DNA fragmentation (https://pubs.acs.org/doi/10.1021/acs.bioconjchem.5b00665). However, no direct evidence of Cu ions interfering with the PCR step of ClickSeq has been found or reported.
Nevertheless, in the current protocol, Cu ions and the components of the Click-ligation reaction are removed using SPRI beads and only purified nucleic acids proceed to the PCR reaction.
Please contact us at info@clickseq.com for any technical questions
ClickSeq has since been used in numerous publications, by the original inventors, by clients who have purchases ClickSeq kits and/or services as well as independent groups who have assembled their own reagents. See here for a curated list of publications:
Our current kits provide sufficient reagents to generate 12 unique ClickSeq libraries. We also provide a kit containing indexing primers with 12 unique i7 barcodes. To multiplex more that 12 libraries, standard i7 adaptors from other vendors or in-house synthesized primers would be compatible provided they have the same structure as described below. The current kits are developed for single-indexing. Dual-indexing requires specific i5 indexing primers, which are not compatible with the current single-index kit.
Our current kits come preformulated with a master mix for the reverse transcription reaction that already contains the appropriate primer/nucleotide mixes required. Future versions of our kits will allow customization/addition using bespoke RT primers. Please reach out to us at info@clickseq.com for further information or if you wish to design specific assays.
We have used numerous reverse transcriptase for ClickSeq. We recommend using the SuperScript family of enzymes (e.g. SSIII, SSIV) https://www.thermofisher.com/order/catalog/product/18080044) as these have been the most extensively validated. Group II intron RTs are also compatible with ClickSeq and can be used in specific applications such as DMS-MapSeq (e.g. https://pubmed.ncbi.nlm.nih.gov/31799606/)
We have found that this step can improve the yield of some ClickSeq library preps (https://pubmed.ncbi.nlm.nih.gov/29224069/), but it is not essential and can be removed to reduce expense and turnaround time. The original RNA is mostly removed/degraded during the RT enzyme denaturation, the subsequent click-ligation reaction and the bead-clean up.
SuperScript III™ Reverse Transcriptase, 200U/µL (Invitrogen; 18080-093 or 18080-044)
OneTaq® 2X Master Mix with Standard Buffer (NEB; M0482S or M0482L) (Note: you must use OneTaq for this step, this enzyme cannot be substituted for a different PCR enzyme)
SPRIselect (Beckman Coulter; B23317) or equivalent DNA/RNA Purification Beads (also known as SPRI beads)
Nuclease free water
80% ethanol (made fresh)
[optional] RNaseOUT™ Recombinant Ribonuclease Inhibitor, 40U/µL (Invitrogen; 10777)
[optional] RNase H, 5000 units/mL (NEB; M0297S or M0297L)
Standard Molecular Lab equipment required:
UV-spectrophotometer or equivalent (for RNA quantification)
Single-channel pipettes (1 - 1000µl)
Thermocycler
Magnetic rack, for 0.2mL PCR strip tubes or 96-well plates
Benchtop centrifuge (for quick-spin collection of reagents, 1.5mL tube and 0.2mL PCR strip compatible)
Vortex
Ice box or equivalent
[optional] Multi-channel pipettes (1 - 200µl)
[optional] Qubit fluorometer, with dsDNA High Sensitivity reagents
[optional] Agilent BioAnalyzer, with High Sensitivity DNA reagents and chip
Tips, RNase-free and low-binding (aerosol barrier recommended)
1.5mL tubes, RNase-free and low-binding recommended
0.2mL thin-walled PCR tubes or 96-well plates with caps or sealing film
Yes. Since the process uses magnetic beads for the clean-up steps and size-selection, ClickSeq and Poly(A)-ClickSeq are in principle fully automatable. We do not currently support specific instrumentation, but for more information, please reach out to us at info@clickseq.com
A ClickSeq library takes approximately 5-6 hours to make from original sample to sequencing-ready library. This comprises approximately 2 hrs of hands-on time and 3 hrs of incubation/wait times. Additional steps, such as including an RNaseH treatment and/or additional PCR cycles, will extend this turnaround time.
Most of the steps of the ClickSeq protocol as similar to those commonly employed in other standard RNAseq/DNAseq library preparation approaches. The only ‘atypical’ step, at least at far as NGS library prep is concerned, is the click-ligation step. This step is time-sensitive since the reduced copper catalyst is vulnerable to re-oxidation by atmospheric oxygen. Once the ‘Click Catalyst’ and ‘Click Accelerant’ have been mixed, the user must proceed immediately to add this mixture to the cDNA/adaptor mixture. This is noted clearly in the protocol.
The ‘Click-Catalyst’ contains copper ions that are reduced to a +1 oxidation state by the ‘Click-Accelerant’, which is essential for the copper-catalysed azide alkyne cycloaddition (CuAAC) used for the click-ligation step. This step is time sensitive since atmospheric oxygen can oxidise the copper ions back to a +2 oxidation step, which cannot perform CuAAC.
We have tested numerous PCR enzymes. Only some enzymes/polymerases are capable of traversing the triazole-linkage present in the click-linked cDNA. Commonly used ‘high-fidelity’ enzymes such as Q5™, HiFi™, Phusion™, etc, are not able to jump over the triazole linkage and as such cannot be used/substituted in the final PCR. We have found the OneTaq™ from NEB provides the most efficient read-through of the triazole linkage. OneTaq™ also has the benefit of being highly robust and processive even on difficult and GC-rich templates.
No.
Many of these enzymes cannot efficiently cross the triazole-linkage in the click-linked cDNA generated by ClickSeq and will thus fail to produce a final NGS library.
Any high quality RNA/DNA can be used as a positive control. We recommend using 500ng of commercially available reference RNAs (e.g. UHRR; https://www.thermofisher.com/order/catalog/product/QS0639) or RNAs extracted from cell culture.
Pure water
Strong banding patterns in a NGS library is typically the result of PCR bias amplification and/or amplification artefacts such as adaptor/primer dimers. These can be present for a number of reasons, but can most commonly be attributed to poor RNA/DNA quality or quantity and/or over-amplification of the final library. Oftentimes, these bands can still be sequenced and can be useful in diagnosing/troubleshooting sample-specific issues, but the output FASTQ data may lack diversity.
Strong banding patterns in a NGS library is typically the result of PCR bias amplification and/or amplification artefacts such as adaptor/primer dimers. These can be present for a number of reasons, but can most commonly be attributed to poor RNA/DNA quality or quantity and/or over-amplification of the final library. Oftentimes, these bands can still be sequenced and can be useful in diagnosing/troubleshooting sample-specific issues, but the output FASTQ data may lack diversity.
Our protocol can be found here:
https://www.protocols.io/view/clickseq-random-primed-protocol-with-single-indexi-n92ld8jkov5b/v1
The number of PCR cycles to perform will depend on the sample type (species, tissue, quality, etc.) so optimizations should be completed prior to processing all samples of the same type. This protocol has been extensively tested using total cellular RNA extracted from D. melanogaster (S2) cells. The provided values should be used as a reference only.
RNA PCR CYCLES
20ng 18-21
50ng 17-20
100ng 16-19
250ng 12-18
Yes. Whatever you put into your NGS prep is what you will sequence, with the exception of very short RNAs (see comment above).
Yes.
ClickSeq can sequence DNA with the same protocol as used for RNAseq provided that the RT enzyme has DNA-templated DNA polymerase activity (such as SuperScript III/IV). Published examples of this can be found here:
https://academic.oup.com/gigascience/article/doi/10.1093/gigascience/giad009/7080818
In our ClickSeq kits, our RT reaction is optimized to yield cDNA fragments 300-600 nts in length, which is ideal for most RNAseq projects. However, since ClickSeq relies on the stochastic incorporation of azido-nucleotides into cDNA during reverse transcription, the reverse transcriptase might reach the end of a small RNAs before an azido-nucleotide is incorporated. As a result, the cDNA cannot be click-ligated to the sequencing adaptor and thus will not be sequenced.
To capture small RNAs, a lower azido-nucleotide to deoxynucleotide ratio must be used in the RT mix than what we currently provide in the ClickSeq kits (e.g. a 1:5 ratio would be preferred). Please reach out to us at BaseClick GmbH/ ClickSeq Technologies LLC if you would like to inquire about the option of making bespoke RT mixes with specific AzNTP:dNTP ratios
ClickSeq will sequence whatever nucleic acid is provided as input. If you have total cellular RNA, then much of this will comprise rRNA. mRNAs or other poly(A)-tail containing RNAs can be enriched using standard commercial Poly(A)-enrichment kits.
Published examples of this can be found here:
https://www.sciencedirect.com/science/article/abs/pii/S1046202318302275?via%3Dihub
Yes. ClickSeq can sequence up until the first 5’ nucleotide of any input RNA/DNA. For example, Tiled-ClickSeq has been employed to discover novel SNVs present in the 5’ UTR of specific SARS-CoV-2 variants https://elifesciences.org/articles/68479
In random-primed ClickSeq, the 6N random primer will occlude the resolution of the last 6 nucleotides of any RNA/DNA. Read coverage over the 3'end of RNA/DNA is generally reduced.
In Poly(A)-ClickSeq, the oligo-dT primer intitiates cDNA synthesis within in the poly(A)-tail and is capable of idenifiying the exact junction of the 3’UTR and poly(A)-tail.
Carrier RNA should be used with caution. Although it may improve the yield of certain RNA extraction procedures, the presence of carrier RNA in the RT reaction will result in cDNA being synthesized from this RNA. As a result, the final FASTQ data maybe dominated by carrier RNA sequences. This is particularly problematic in Poly(A)-ClickSeq, since carrier RNAs are commonly poly(A)-oligos, and this will be sequenced. Some carrier RNAs are small (e.g. tRNAs). These are unlikely to be targeting during Poly(A)-ClickSeq, since they should not contain poly(A)-tracts. Further, carrier tRNAs may be short enough that azido-nucleotide incorporation during reverse transcription is limited (since the AzNTP:dNTP is optimized for cDNA fragments 300-600 in length) and any resultant library from a tRNA would be very small and easily excluded during size-selection (e.g. in the final SPRI bead purification step and/or optional agarose-gel extraction).
The primer used in the reverse transcription step is:
5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNN
The Click-Adaptor present in the ClickMix is:
5’-Hexynyl-NNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
The forward primer in the PCR step is:
5’-AATGATACGGCGACCACCGAG
The i7 Indexing primer in the PCR step is:
5’-CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGT
where 'xxxxxx' denotes the chosen i7 index.
A final ClickSeq library should appear as a smooth, even smear of DNA fragments ranging from around 300-700 nts in length, with a peak around 450nts. For examples of this, please see previous publications: e.g. https://link.springer.com/protocol/10.1007/978-1-4939-7514-3_6
Yes. ClickSeq was originally published in 2015 by Routh et al in the Journal of Molecular Biology:
https://www.sciencedirect.com/science/article/abs/pii/S0022283615003514?via%3Dihub
Our protocol can be found here:
https://www.protocols.io/view/poly-a-clickseq-poly-a-primed-protocol-with-single-n2bvjnb5xgk5/v1
The number of PCR cycles to perform will depend on the sample type (species, tissue, quality, etc.) so optimizations should be completed prior to processing all samples of the same type. This protocol has been extensively tested using total cellular RNA extracted from D. melanogaster (S2) cells. The provided values should be used as a reference only.
RNA PCR CYCLES
100ng 17-19
500ng 16-18
1µg 13-15
2µg 12-14
No! Do not use carrier RNA.
Carrier RNAs are commonly poly(A)-oligos and this will be sequenced. Some carrier RNAs are small (e.g. tRNAs). These are unlikely to be targeted during Poly(A)-ClickSeq, since they should not contain poly(A)-tracts. Further, carrier tRNAs may be short enough that azido-nucleotide incorporation during reverse transcription is limited (since the AzNTP:dNTP is optimized for cDNA fragments 300-600 in length) and any resultant library from a tRNA would be very small and easily excluded during size-selection (e.g. in the final SPRI bead purification step and/or optional agarose-gel extraction).
The primer used in the reverse transcription step is:
5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNTTTTTTTTTTTTTTTTTTTTT
The Click-Adaptor present in the ClickMix is:
5’-Hexynyl-NNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
The forward primer in the PCR step is:
5’-AATGATACGGCGACCACCGAG
The i7 Indexing primer in the PCR step is:
5’-CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGT
where 'xxxxxx' denotes the chosen i7 index.
A final ClickSeq library should appear as a smooth, even smear of DNA fragments ranging from around 200-500nts in length, with a peak around 350. For examples of this, please see previous publications: e.g. https://pubmed.ncbi.nlm.nih.gov/28449108/
Since Poly(A)-ClickSeq is designed to capture the junction of the poly(A)-tail and adjacent 3’UTR, the azidonucleotide to deoxynucleotide ratio is lower in Poly(A)-ClickSeq than ClickSeq, resulting in shorter cDNA fragments.
Yes. Poly(A)-ClickSeq was originally published in 2017 by Routh et al in Nucleic Acids Research (NAR):
ClickSeq generates standard, stranded RNAseq data in either single-end or paired-end format, as specified by the user. As such, standard practices for filtering, adaptor-trimming and aligning are appropriate.
The only exception is that ClickSeq typically adds an additional ‘A’ at the site of the triazole linkage formed during Click-ligation. We recommend trimming this addition A away from the R1 read. As this is also the location of the 4N UMI, we therefore recommend trimming the first 5 or 6 nts away from the R1.
ClickSeq is reported to have ultra-low chimera rates (<3 events per million reads), making ClickSeq an ideal tool to study RNA recombination, fusions and chimerism in biological specimens such as virus or vaccine stocks.
The single-nucleotide error rate is primarily driven by the DNA polymerase(s) used in the final PCR reaction. We recommend using OneTaq (NEB), which is a mixture of Deep Vent Polymerase and Taq. The error rate reported by NEB is approximately 160x10^-6. This corresponds to a PHRED score of approximately 38. This is higher (better) than the typical base-calling error rate of current Illumina flowcells, and as such is not the leading cause of error in the output FASTQ data and is equivalent to other RNAseq strategies.
See https://www.mdpi.com/1999-4915/13/12/2508 for a study using ClickSeq to measure the properties and mutagenizing potential of antiviral therapies.
Nevertheless, PCR-derived single-nucleotide errors can be controlled for and corrected using the Unique Molecular Identifiers (UMIs). The current kits contain 4 nts in the UMI. For longer or customized UMIs/barcodes, please reach out to us a info@clickseq.com
ClickSeq is reported to have ultra-low chimera rates (<3 events per million reads), making ClickSeq an ideal tool to study RNA recombination, fusions and chimerism in biological specimens such as virus or vaccine stocks. This rate can be directly measured by ad hoc mixing of biologically orthogonal templates prior to reverse transcription. The reduce chimera rates is likely due to; 1) the removal of RNA fragmentation steps removes the chance for the RT enzyme to reach the 5’ terminus of an RNA fragment, which would subsequently result in template switching to another RNA fragment; 2) the azido-nucleotide termination prevents continued synthesis of cDNA and thus prevents further template switching; 3) the replacement of the enzymatic ligation steps commonly used in most RNAseq and DNAseq approaches with click-chemistry prevent chimera formation since this only allows ligation of the 3’-azido-terminated cDNAs to the 5’ alkyne-functionalized sequencing adaptors. This reaction is completely biorthogonal, which prevents the formation of chimeras between RNA/DNA fragments.
The current kits contain 4 nts in the UMI. For longer or customized UMIs/barcodes, please reach out to us at info@clickseq.com
A number of pipelines have been developed and published for the processing and analysis of 3’-end focused or poly(A)-focused RNAseq data. The ‘DPAC’ (Differential Poly(A)-Clustering) tool was specific designed with Poly(A)-ClickSeq data in mind (https://academic.oup.com/g3journal/article/9/6/1825/6027998) and can be used to process raw Poly(A)-ClickSeq data, align to a reference genome, extract gene counts, and identify (de novo) the positions of Poly(A)-tails in the 3’UTRs of mRNAs. For support or to enquire about bioinformatics services for analysing ClickSeq data, please reach out to us at info@clickseq.com
Yes.
Your local sequencing/genomics/NGS core may purchase Poly(A)-ClickSeq/ClickSeq kits. The equipment and expertise of any typical genomics core will be sufficient and the protocol would be routine.
Yes. We can also provide Poly(A)-ClickSeq/ClickSeq library prep, sequencing and bioinformatics at ClickSeq Technologies LLC. Please see https://www.clickseqtechnologies.com/services for more details and/or reach out to us at info@clickseq.com
Yes. We are experts in NGS, transcriptomics and genomics analyses. We can provide routine bioinformatic services and/or custom consulting/support for more in-depth analyses and projects. Please reach out to info@clickseq.com for more information.